126
126
Oct 31, 2012
10/12
by
CURRENT
tv
eye 126
favorite 0
quote 0
eliot is joining us on the phone. thanks so much for being inside "the war room" tonight by phone. >> eliot: jennifer, my pleasure and thanks for all of the attention to what is going on in new york state and new york city. >> jennifer: what is your experience? obviously your show has been canceled at least i'm speaking up a portion of that as well as cenk uygur. for you personally, what have you been seeing? >> we couldn't go on the air as demonstrative of the damage being done across the city, lack of power lack of transportation. obviously in the low-lying areas where the water was surging through communities and destroying power stations and flooding tunnels the devastation, the loss of life is just enormous. it makes you realize not only how powerful water is, absolutely nothing can stop it. when it surges through it just comes barreling through. no matter what man has created water wins that fight and a city as complicated as new york, when you realize what is beneath the street is often as complicated as what y
eliot is joining us on the phone. thanks so much for being inside "the war room" tonight by phone. >> eliot: jennifer, my pleasure and thanks for all of the attention to what is going on in new york state and new york city. >> jennifer: what is your experience? obviously your show has been canceled at least i'm speaking up a portion of that as well as cenk uygur. for you personally, what have you been seeing? >> we couldn't go on the air as demonstrative of the...
163
163
Oct 18, 2012
10/12
by
CURRENT
tv
eye 163
favorite 0
quote 0
can "actually" use. but with those single mile travel cards... [ bridesmaid ] blacked out... but i'm a bridesmaid. oh! "x" marks the spot she'll never sit. but i bought a dress! a toast... ...to the capital one venture card. fly any airline, any flight, anytime. double miles you can actually use. what a coincidence? what's in your wallet? [ all screaming ] watch the elbows ladies. >> cenk: i love this aggressive progressive segment and i can't wait to do it to a banker. the ceo of citigroup, in his five. year watch he was an epic disaster. do you know how much of their value they lost in five years? only 88%. they lost 88% of their value! share price gone down. i know there was a crash in there, but it's not like they were faultless for the crash. they caused the crash along with other banks and they never recovered because they suck, right? so obviously if you lose 88% of your share you're not going to get paid that much, right? wrong again, bob they're bankers. look at how much they got paid over those
can "actually" use. but with those single mile travel cards... [ bridesmaid ] blacked out... but i'm a bridesmaid. oh! "x" marks the spot she'll never sit. but i bought a dress! a toast... ...to the capital one venture card. fly any airline, any flight, anytime. double miles you can actually use. what a coincidence? what's in your wallet? [ all screaming ] watch the elbows ladies. >> cenk: i love this aggressive progressive segment and i can't wait to do it to a...
314
314
Oct 17, 2012
10/12
by
CURRENT
tv
eye 314
favorite 0
quote 0
us binders full of women. without enough college graduates to fill them. that's why at devry university we're teaming up with companies like cisco to help make sure everyone is ready with the know-how we need for a new tomorrow. [ male announcer ] make sure america's ready. make sure you're ready. at devry.edu/knowhow. ♪ ♪ from silver screens... to flat screens... twizzlerize your entertainment everyday with twizzlers the twist you can't resist. cook what you love and save your money. joe doesn't know it yet, but he'll work his way up from busser to waiter to chef before opening a restaurant specializing in fish and game from the great northwest. he'll start investing early, he'll find some good people to help guide him, and he'll set money aside from his first day of work to his last, which isn't rocket science. it's just common sense. from td ameritrade. >> cenk: i love this aggressive progressive segment and i can't wait to do it to a banker. the ceo of citigroup, in his five. year watch he was an epic
us binders full of women. without enough college graduates to fill them. that's why at devry university we're teaming up with companies like cisco to help make sure everyone is ready with the know-how we need for a new tomorrow. [ male announcer ] make sure america's ready. make sure you're ready. at devry.edu/knowhow. ♪ ♪ from silver screens... to flat screens... twizzlerize your entertainment everyday with twizzlers the twist you can't resist. cook what you love and save your money. joe...
192
192
Oct 16, 2012
10/12
by
CURRENT
tv
eye 192
favorite 0
quote 0
in 2004 there were techniques used in ohio such as caging. and this was under rove's direction, the republicans would send out massive emails to democratic neighborhoods, african-americans tend to vote more than 90% for democratic and it wasn't clear those votes would be accounted for. >> jennifer: so sproul set up these -- like the clip of the young woman we saw only registering republicans. and that's of course unlawful, so he is under investigation. in florida when this was unearthed. the republican party said we have cut ties with him, but apparently rove is still hiring this guy. >> right, and the l.a. times reported that he is still active as of october 2012. and you have to wonder if these polls are counting people who's votes may not actually be counted. >> jennifer: "the los angeles times" has wrote about it why aren't these things willing stopped? >> it takes forever to be investigated. to investigate in real time is very difficult. >> jennifer: do you think what he is doing could impact this election? >> oh, absolutely. there has b
in 2004 there were techniques used in ohio such as caging. and this was under rove's direction, the republicans would send out massive emails to democratic neighborhoods, african-americans tend to vote more than 90% for democratic and it wasn't clear those votes would be accounted for. >> jennifer: so sproul set up these -- like the clip of the young woman we saw only registering republicans. and that's of course unlawful, so he is under investigation. in florida when this was unearthed....
96
96
Oct 31, 2012
10/12
by
CURRENT
tv
eye 96
favorite 0
quote 0
she joins us from washington, d.c. where she's just digging out from the storm or at least recovering. welcome back inside "the war room," keke. >> grad to see you governor. how are you this evening? >> jennifer: i'm doing great. drier than you all are. things are going to open up tomorrow in d.c. tomorrow i understand. >> i think they will. >> jennifer: let's talk about the crisis first. what's the best way to respond to a crisis like this from the point of view -- let's just say of both the incumbent and the challenger? >> yeah. well the incumbent needs to do his job. he needs to be the leader that he was elected to be and i think you see that happening in the case of president obama. when you hear from his fellow leaders like chris christie and like mayor nutter in philadelphia that he's been the kind of leader who's getting the resources folks need on the ground to deal with this crisis. that's the most important thing. failed leadership is deadly in this case. but in this case, i think we're seeing a president ste
she joins us from washington, d.c. where she's just digging out from the storm or at least recovering. welcome back inside "the war room," keke. >> grad to see you governor. how are you this evening? >> jennifer: i'm doing great. drier than you all are. things are going to open up tomorrow in d.c. tomorrow i understand. >> i think they will. >> jennifer: let's talk about the crisis first. what's the best way to respond to a crisis like this from the point of...
163
163
Oct 30, 2012
10/12
by
CURRENT
tv
eye 163
favorite 0
quote 0
she is joining us from madison, wisconsin. kristin welcome back inside "the war room." >> thank you so much for having me, governor. >> jennifer: you bet. when we last talked to you, you were in the throws of battling this scott brown recall stuff. how is early voting doing? and do we have any idea who has the edge of that in wisconsin? >> we have been very pleased with the way that early vote is shaping up. we have had lines every day in our democratic base areas across the state, we have had rallies and events and we feel like we have the edge in early vote it started a week ago and we have seen lines ever since. so we're very excited. >> jennifer: wisconsin's early voting ends the friday before the election instead through the weekend, how does that affect your efforts to get out the vote? >> we know on saturday mornings we'll have thousands of volunteers out pounding the pavement and communicating with voters to get that vote out on tuesday. there is a final push at the end of the week to get every early vote cast come fri
she is joining us from madison, wisconsin. kristin welcome back inside "the war room." >> thank you so much for having me, governor. >> jennifer: you bet. when we last talked to you, you were in the throws of battling this scott brown recall stuff. how is early voting doing? and do we have any idea who has the edge of that in wisconsin? >> we have been very pleased with the way that early vote is shaping up. we have had lines every day in our democratic base areas...
224
224
Oct 18, 2012
10/12
by
CURRENT
tv
eye 224
favorite 0
quote 0
i went to a number of women's groups and said can you help us find folks and they brought us whole binders full of women. >> jennifer: binders full of women. but behind the awkward ward beaver meets hugh hefner wording, there still were no specifics. he still has not said if he supports the lilly ledbetter act. you'll remember this answer. >> jennifer: crickets. well, it's october, and we are still waiting. last night actually senior advisor, ed gillespie told the "huffington post" that mitt romney would not have signed the lilly ledbetter fair pay act into law, but then today ed gillespie did an about face and he said, quote . . . he never weighed in on it. he is just a blank canvas waiting for you to guess what he thinks and what we'll do. and that lack of specifics might be helping with women. lake research partners said 5 f% of women in swing states felt that the president won compared to 34% said that romney did. maybe last night brought the women back. on the campaign trail both candidates seemed to be angling for the female vote. the president stood in front of a virtual wall of wom
i went to a number of women's groups and said can you help us find folks and they brought us whole binders full of women. >> jennifer: binders full of women. but behind the awkward ward beaver meets hugh hefner wording, there still were no specifics. he still has not said if he supports the lilly ledbetter act. you'll remember this answer. >> jennifer: crickets. well, it's october, and we are still waiting. last night actually senior advisor, ed gillespie told the "huffington...
273
273
Oct 13, 2012
10/12
by
CURRENT
tv
eye 273
favorite 0
quote 0
can you parse that out for us? >> well, what happened basically because this movie was making its way around the middle east. you had the -- you know, the demonstrations in cairo, and then what happened in libya, people made the assumption in fact general clapper who was first appointed to a high post in the pentagon by the bush administration, he came out and said no, and the administration took that, and ambassador rice used that. and then general clapper came out and said no, wewrong, and here is what happened. and once he did the administration changed the narrative. so what people are saying well you were wrong. well, yes, they were the intelligence was wrong in the beginning, but what was most disturbing about what congressman ryan was saying last night. is first of all he doesn't know the difference between an embassy and a consulate. marines don't provide security for ambassadors. we had another group, security group on call in -- in benghazi so this idea that somehow you would send more marines don't guard
can you parse that out for us? >> well, what happened basically because this movie was making its way around the middle east. you had the -- you know, the demonstrations in cairo, and then what happened in libya, people made the assumption in fact general clapper who was first appointed to a high post in the pentagon by the bush administration, he came out and said no, and the administration took that, and ambassador rice used that. and then general clapper came out and said no, wewrong,...
313
313
Oct 30, 2012
10/12
by
CURRENT
tv
eye 313
favorite 0
quote 0
i hope steph feels better. >> us too. i hope she is her tomorrow because we have elvira and mark hamel from star wars. >> that's great. i got to tell you, yesterday during the height of the weather, the storms we got a live phone call, and a robo call that mittens is going to be here in [ inaudible ] michigan. >> i heard fund-raising emails but i didn't hear anything about robo calls. >> it sounds like he is still campaigning. >> caller: no not mittens. [ laughter ] >> yeah, that's a great point. we seem to be getting mixed messages from his campaign. i think he is missing that sensitivity gene. >> by suspending his campaign it means calling it something else. >> did he go to costco and get the three-pack shirt. >> oh these are marvellous. >> the three packs that don't exist. >> exactly. george in ohio. hey george. >> caller: hey, how is it going over there at the "stephanie miller show." >> we're doing there without stephanie. >> caller: i know. i know. >> we miss here. >> caller: yeah i do miss her too. jacki is doing a
i hope steph feels better. >> us too. i hope she is her tomorrow because we have elvira and mark hamel from star wars. >> that's great. i got to tell you, yesterday during the height of the weather, the storms we got a live phone call, and a robo call that mittens is going to be here in [ inaudible ] michigan. >> i heard fund-raising emails but i didn't hear anything about robo calls. >> it sounds like he is still campaigning. >> caller: no not mittens. [ laughter...
377
377
Oct 18, 2012
10/12
by
CURRENT
tv
eye 377
favorite 0
quote 0
i went to a number women's groups can you help us find folks, and they brought us binders full of women. >> eliot: but according to the coalition groups at a fill those binders romney told the story backyards. she told the "huffington post" that hiving top-level women was an initiative of women's organizations to make it be something that he had to follow through on. he didn't go out looking for these binders. romney also bled a bit when he dualed with the president over their personal investments. >> romney: mr. president, have you looked at your pension? mr. president, have you looked at your pension. >> obama: i don't look at my pension. it's not big as yours, it doesn't take me long. >> eliot: and romney struggled over the strike that killed four americans in ben gas did i. >> obama: the day after the attack i stood in the rose garden and told the american people of the world that we were going to find out exactly what happened. that this was an act of day after the attack that it was an act of terror? it was not a spontaneous demonstration, is that what you're saying? >> obama: ple
i went to a number women's groups can you help us find folks, and they brought us binders full of women. >> eliot: but according to the coalition groups at a fill those binders romney told the story backyards. she told the "huffington post" that hiving top-level women was an initiative of women's organizations to make it be something that he had to follow through on. he didn't go out looking for these binders. romney also bled a bit when he dualed with the president over their...
349
349
Oct 29, 2012
10/12
by
CURRENT
tv
eye 349
favorite 0
quote 0
double miles you can "actually" use. but with those single mile travel cards... [ bridesmaid ] blacked out... but i'm a bridesmaid. oh! "x" marks the spot she'll never sit. but i bought a dress! a toast... ...to the capital one venture card. fly any airline, any flight, anytime. double miles you can actually use. what a coincidence? what's in your wallet? [ all screaming ] watch the elbows ladies. [ ♪ theme music ♪ ] >> cenk: all right, we're back on "the young turks." you're looking at images of 14th and 8th in new york where the disasters have gun unfortunately, as the storm picks up in intensity. why is it picking up in intensity? well we believe not we as in "the young turks," but we as the scientists of the world believe if you have climate change you will get more severe storms. here we have a giant unprecedented storm that combines many different fronts into one, that is larger than anything that the atlantic coast has seen. let me give you quotes from scientists. here is the capital weather gang. the largest
double miles you can "actually" use. but with those single mile travel cards... [ bridesmaid ] blacked out... but i'm a bridesmaid. oh! "x" marks the spot she'll never sit. but i bought a dress! a toast... ...to the capital one venture card. fly any airline, any flight, anytime. double miles you can actually use. what a coincidence? what's in your wallet? [ all screaming ] watch the elbows ladies. [ ♪ theme music ♪ ] >> cenk: all right, we're back on "the...
197
197
Oct 20, 2012
10/12
by
CURRENT
tv
eye 197
favorite 0
quote 0
thank you for joining us. >> thank you for inviting me. >> eliot: for those of us who are old enough the bond movies you're q and bond all in one. you create the disguises, the exciting way to get people out of a country. you go in, you do it all this is incredible. >> well, i think somebody needs to do it. and guess what, they're doing it better than i did these days. >> eliot: it's a fascinating thing. you joined the c.i.a. in 1965, am i correct? >> that's right. >> eliot: and at the time because of your artistic skills you were in charge of disguises. tell us about that. what was that all about? >> the way you work in the field you need to be invisible half the time. so you got to have alternate identities and the various ways of using and making those is a big part of the espionage business. it's kind of like robbing banks when nobody knows the money is gone. you go back each week and take more money. >> eliot: again i think you're eagle extraordinarily modist. you were devicing, building these tricky devices. i saw one reference to cats with microphones on them. and high tech, h
thank you for joining us. >> thank you for inviting me. >> eliot: for those of us who are old enough the bond movies you're q and bond all in one. you create the disguises, the exciting way to get people out of a country. you go in, you do it all this is incredible. >> well, i think somebody needs to do it. and guess what, they're doing it better than i did these days. >> eliot: it's a fascinating thing. you joined the c.i.a. in 1965, am i correct? >> that's right....
222
222
Oct 30, 2012
10/12
by
CURRENT
tv
eye 222
favorite 0
quote 0
how do you talking to us? >> i do. my old place lost it, and the place i almost moved to last month was evacuated. it was pretty terrible, i had pieces of debris and metal blowing on to my roof a lot of noise, but generally we were lucky and we did okay. but the devastation is pretty terrible. i applaud both campaigns for not wanting to politicize the storm, because that's for later in the week. i think everyone in new york is very impressed with the local response and how local and federal government seems to have really come together. and fema really has improved in the last five years. >> yeah. >> i want to give credit to fox news, because they did the best coverage, and they had frank luntz and ann coulter on at the same time in hopes that the sheer evil would keep the storm away. >> i saw mayor bloomberg on the tv, and he is wall an imconspiring person. >> well, yeah. it is tragic for the loss of life although it is compared to haiti, america has nothing to complain about -- >> and you have been to haiti -- >> yea
how do you talking to us? >> i do. my old place lost it, and the place i almost moved to last month was evacuated. it was pretty terrible, i had pieces of debris and metal blowing on to my roof a lot of noise, but generally we were lucky and we did okay. but the devastation is pretty terrible. i applaud both campaigns for not wanting to politicize the storm, because that's for later in the week. i think everyone in new york is very impressed with the local response and how local and...
201
201
Oct 19, 2012
10/12
by
CURRENT
tv
eye 201
favorite 0
quote 0
a disaster for those of us who -- what do you do? what is your next step? >> as someone who does not like the yankees as someone who believes that people who root for the yankees are people like what rooted for the hunter that shot bambi's mom, i believe they should keep a-rod because i think his substandard defense awful hitting gimpy legs and the drain he is on the yankees' payroll o will do marvelous things for brian. >> eliot: i thought you were speaking wisdom until the end. no i don't root against bambi. dave zirin thanks as always for your time. that's "viewpoint" for tonight. have a great >> tonight in the war room, a big day for the romneys. mitt proves once again he's beholding to corporate america. and flip-flops mitt's position on abortion and tagg, yes tagg, physically threatens the president. i swear, it's like we're dealing with the james gang. >> i'm michael shure. jennifer granholm will be back tomorrow. the ceos of some of this country's
a disaster for those of us who -- what do you do? what is your next step? >> as someone who does not like the yankees as someone who believes that people who root for the yankees are people like what rooted for the hunter that shot bambi's mom, i believe they should keep a-rod because i think his substandard defense awful hitting gimpy legs and the drain he is on the yankees' payroll o will do marvelous things for brian. >> eliot: i thought you were speaking wisdom until the end. no...
157
157
Oct 13, 2012
10/12
by
CURRENT
tv
eye 157
favorite 0
quote 0
gentlemen, thank you for being with us on "viewpoint" tonight. i came away from that debate thinking that the vice president really did the job he needed to do. he stopped the bleeding from last week. some people say he started the bleeding of paul ryan and mitt romney, but i think his job in the debate is to end last week for the obama-biden campaign. first i want to ask you, do you think he was able to accomplish that. >> i think he did. he certainly did that last night. he changed the narrative. whether or not the administration was back on its heels, afraid or unable to engage unable to loosen up and take it to the other side, we saw that and more. interestingly enough we have a retroactive answer to why the president last week may be seemed a little stiff, maybe didn't seem so jovial. didn't loosen up and try to engage mitt romney. as we saw last night it can be jarring. not everybody liked it. >> that's something i want to ask you thomas frank this style, are we reading too much into it or did it matter a lot last night. >> it's a vice pres
gentlemen, thank you for being with us on "viewpoint" tonight. i came away from that debate thinking that the vice president really did the job he needed to do. he stopped the bleeding from last week. some people say he started the bleeding of paul ryan and mitt romney, but i think his job in the debate is to end last week for the obama-biden campaign. first i want to ask you, do you think he was able to accomplish that. >> i think he did. he certainly did that last night. he...
147
147
Oct 5, 2012
10/12
by
CURRENT
tv
eye 147
favorite 0
quote 0
thank you both for joining us. it was not so much fun watching last night and today, i kind of had the sense that we've read at different points in our lives about the seven stages of grief. i kind of saw the democratic party working through the stages today. tim, let me ask you are they now beginning to deal with reality and figure out how to put these things back together? >> you know, i actually went back and rewatched the debate today. it was sort of less bad than i think people honestly -- maybe you think i'm in denial but i think this actually was not a tragic debate for the president. i thought he came across as sleepy and a step too slow but other than that, you know, he was fine under substance. he didn't have any notable gaffes. we're not talking about some malapropism that he had last night. he came across as steady and competent. i think you know, we all in the media and partisans on both sides want fireworks in these debates but i think for the low information voters who have been hearing this straw ma
thank you both for joining us. it was not so much fun watching last night and today, i kind of had the sense that we've read at different points in our lives about the seven stages of grief. i kind of saw the democratic party working through the stages today. tim, let me ask you are they now beginning to deal with reality and figure out how to put these things back together? >> you know, i actually went back and rewatched the debate today. it was sort of less bad than i think people...
162
162
Oct 30, 2012
10/12
by
CURRENT
tv
eye 162
favorite 0
quote 0
stay with us. >> this is the blizzard of 2011. it is a giant. >> columbia, south carolina, and nashville, tennessee. both hit 109 their hottest ever. >> cenk: later in the program i'm going to tell you who the elbow is on, the tea party leaders, but who among them is going to lose this election? that's a great list. we'll share that with you later in the program. good morning ladies and gentlemen, i'm captain whitaker. >> there's 102 souls on board. >> let's get em' tucked in we're ready to push. >> current tv knows there are two sides to every story. >> i have no control on my side! >> this is south jet 227, we are in a dive! here we go! brace for impact! >> you saved a lot of lives. >> he was very worried. >> looks like a cool character. >> he reminds you of. >> sully. >> the guy who landed the plane in the hudson. >> he has to be a hero. >> he definitely a hero, yea. >> now, what if you heard the other side of the story? >> i had a couple beers the night before the flight. >> you had alcohol in your system. that could be life i
stay with us. >> this is the blizzard of 2011. it is a giant. >> columbia, south carolina, and nashville, tennessee. both hit 109 their hottest ever. >> cenk: later in the program i'm going to tell you who the elbow is on, the tea party leaders, but who among them is going to lose this election? that's a great list. we'll share that with you later in the program. good morning ladies and gentlemen, i'm captain whitaker. >> there's 102 souls on board. >> let's get...
125
125
Oct 16, 2012
10/12
by
CURRENT
tv
eye 125
favorite 0
quote 0
join us for coverage of the second presidential debate. i'll be here with with governor granholm and john fugelsang. that's only on current tv. coming up, the romney tax plan so riddled with holes that even fox news is not buying it. the ugly truth ahead on "viewpoint." >> eliot: withwith fewer than 24 hours for the next presidential debate, president obama supporters are desperate to see him bounce back from his dismal performance in round one. here is our number of the day 58. that's how many town hall meetings that the president has taken part of since he took office according to cbs news. that's the format of tomorrow's debate. so the president won't have experience to fall back on as an ex-beans. but oftentimes real people can be harsher than the so-called professional media. remember this two years ago. >> quite frankly i'm exhausted. i'm exhausts of you the administration, the change of the man that i voted for and deeply disappointed with where we are right now. i have been told i voted for a man who said he was going to change thi
join us for coverage of the second presidential debate. i'll be here with with governor granholm and john fugelsang. that's only on current tv. coming up, the romney tax plan so riddled with holes that even fox news is not buying it. the ugly truth ahead on "viewpoint." >> eliot: withwith fewer than 24 hours for the next presidential debate, president obama supporters are desperate to see him bounce back from his dismal performance in round one. here is our number of the day 58....
126
126
Oct 27, 2012
10/12
by
CURRENT
tv
eye 126
favorite 0
quote 0
double miles you can "actually" use. but with those single mile travel cards... [ bridesmaid ] blacked out... but i'm a bridesmaid. oh! "x" marks the spot she'll never sit. but i bought a dress! a toast... ...to the capital one venture card. fly any airline, any flight, anytime. double miles you can actually use. what a coincidence? what's in your wallet? [ all screaming ] watch the elbows ladies. [ ♪ theme music ♪ ] >> cenk: president obama actually has been terrific to the bangersthe bankers as we're about to show you but n nevertheless they feel scorned. they did a fundraiser for mitt romney and here is our cnbc covered it. >> a big fundraiser for mitt romney today. for some that's a reversal of support from four years ago when they backed president obama. >> he's smart accomplished and i backed obama the last election, and i'll back mr. romney this election. it's all about the economy. >> romney's message welcoming those in attendance including town thain wilbur ross, and john catsmatidis. he said he needs to do
double miles you can "actually" use. but with those single mile travel cards... [ bridesmaid ] blacked out... but i'm a bridesmaid. oh! "x" marks the spot she'll never sit. but i bought a dress! a toast... ...to the capital one venture card. fly any airline, any flight, anytime. double miles you can actually use. what a coincidence? what's in your wallet? [ all screaming ] watch the elbows ladies. [ ♪ theme music ♪ ] >> cenk: president obama actually has been...
153
153
Oct 19, 2012
10/12
by
CURRENT
tv
eye 153
favorite 0
quote 0
thanks for joining us tonight. nancy, i've gotta ask you everybody knows the first stage of grief is denial. i don't want to suggest it but do you accept the fact that, in fact, the gender gap has disappear and that somehow we're in a new world in terms of how women are voting in this campaign? >> eliot, i don't. i think that the gallup poll is an outlier here. i think that quite conhest i the entire campaign has been about drawing the contrast between president obama who has stood with women the affordable care act whether it was lilly lilly ledbetter and a guy in mitt romney who believes women should be in binders and as though he doesn't even know some of the women he could bring to his cabinet. so i don't believe at the end of the day that gender gap that you're seeing a little bit of now is going to present itself in the voting booth. i believe that women are going to vote for barack obama because they understand what's at stake. and they understand that their reproductive rights and the right to an abortion i
thanks for joining us tonight. nancy, i've gotta ask you everybody knows the first stage of grief is denial. i don't want to suggest it but do you accept the fact that, in fact, the gender gap has disappear and that somehow we're in a new world in terms of how women are voting in this campaign? >> eliot, i don't. i think that the gallup poll is an outlier here. i think that quite conhest i the entire campaign has been about drawing the contrast between president obama who has stood with...
192
192
Oct 31, 2012
10/12
by
CURRENT
tv
eye 192
favorite 0
quote 0
give us a call follow us on twitter @bpshow. we have a very special guest in studio, stopped buy, he is going to new jersey later in the day, but stopped by here on his way to andrews air force base -- >> wow what an honor. >> bill, good to see you. >> bill: how are you and chris christie getting along? >> we're getting along famously. >> bill: all right, very good. >> hey happy halloween! >> i got that mask at target. >> bill: you did, woe? >> yeah, we noticed it needs to be a little grayer. >> bill: yeah, you brought this a couple of years ago. >> yeah, it is historically inaccurate. >> bill: it is pretty good. thanks for getting into the spirit of the program here. i was waiting for the rest of the team to dress up today. >> sorry. >> dan dressed as a national's disgruntled fan. >> bill: so neil it's an exciting time time, right? >> six days to go is that where we are? >> bill: five -- no six. and who is talk about the campaign? >> everybody has moved in a lot of ways back to the campaign there is a lot of talk still about sa
give us a call follow us on twitter @bpshow. we have a very special guest in studio, stopped buy, he is going to new jersey later in the day, but stopped by here on his way to andrews air force base -- >> wow what an honor. >> bill, good to see you. >> bill: how are you and chris christie getting along? >> we're getting along famously. >> bill: all right, very good. >> hey happy halloween! >> i got that mask at target. >> bill: you did, woe?...
131
131
Oct 26, 2012
10/12
by
CURRENT
tv
eye 131
favorite 0
quote 0
he thinks us republicans, we vote based on race. if there is a black quite versus a white guy we vote for the white guy. that's what cool bin powell is doing, too. no colin powell has a brain. 's not a gut reaction racist like you john sunuunu. apparently he felt bad about this again this is the eighth time he has done it on the campaign trail specifically about race. he walked it back today and said i do not doubt it was based on anything but his support of the president's policies. expect when you said it was about race. >> he's miserable miserable guy, john sununu. and he's the living embodiment of that party of a thousand years ago. >> cenk: why are they doing this. if they send sununu out he at least three different times made racial attacks on the president. do they think they he have not shored up the racial vote yet. >> it has something to do him getting elect the. but after it's all done, once you say something and you say it to the people you wanted to say it to, saying later well, i didn't think it that way. it stays with
he thinks us republicans, we vote based on race. if there is a black quite versus a white guy we vote for the white guy. that's what cool bin powell is doing, too. no colin powell has a brain. 's not a gut reaction racist like you john sunuunu. apparently he felt bad about this again this is the eighth time he has done it on the campaign trail specifically about race. he walked it back today and said i do not doubt it was based on anything but his support of the president's policies. expect...
212
212
Oct 8, 2012
10/12
by
CURRENT
tv
eye 212
favorite 0
quote 0
thank you for joining us. the "full court press" coming to you live across this great land of yours, coast-to-coast. in every nook and cranny of america, we are there with you on your local progressive talk radio station and on current tv. and good to have you with us. appreciate very much. you are a very important part of the program, and we would love to here from you on the events of the day at 866-55-press. give us your take on the news of the day. take advantage of that toll-free line at 866-557-7377. we have the team in place lead of course by peter ogburn. dan henning has the day off, and siprion off this week on special assignment. monty is filling in for him as our videographer for the vehicle. good to have him on board as well. couple of trips to tell you about. first of all, i'm very excited to get back to ashville north carolina. this friday anywhere in the mountains of north carolina western colorado anywhere within striking distance come on buy, i'm going to be there with the whole gang from 880
thank you for joining us. the "full court press" coming to you live across this great land of yours, coast-to-coast. in every nook and cranny of america, we are there with you on your local progressive talk radio station and on current tv. and good to have you with us. appreciate very much. you are a very important part of the program, and we would love to here from you on the events of the day at 866-55-press. give us your take on the news of the day. take advantage of that toll-free...
122
122
Oct 31, 2012
10/12
by
CURRENT
tv
eye 122
favorite 0
quote 0
he's joining us now. he's cohost with david sirota in denver the cohost a.m. 630khow in denver, the station they're on. michael brown, thank you so much for joining us. >> my pleasure. how are you guys doing? >> cenk: great. so michael of course, everybody is wondering about this comment. what in the world do you mean that president obama moved too fast in this case to deal with this storm? >> there's really no explaining because -- the article -- the reporter calls -- talk about the politics of disaster. c k: cha tst' shame. ironically, we're having trouble with his communication. now by the way of course, there was a giant miscommunication between michael brown and george w. bush. that's why i say ironically because after george bush said he was doing a heck of a job then he, of course, went on to blame michael brown later for all of the problems. then brown wrote a book in which he said president bush was "didn't get it. he failed to comprehend the magnitude of the storm and that the president tended t
he's joining us now. he's cohost with david sirota in denver the cohost a.m. 630khow in denver, the station they're on. michael brown, thank you so much for joining us. >> my pleasure. how are you guys doing? >> cenk: great. so michael of course, everybody is wondering about this comment. what in the world do you mean that president obama moved too fast in this case to deal with this storm? >> there's really no explaining because -- the article -- the reporter calls -- talk...
333
333
Oct 5, 2012
10/12
by
CURRENT
tv
eye 333
favorite 0
quote 0
thank you for joining us, i really appreciate it. >> my pleasure. take care. >> cenk: stay tune for that segment, and we'll bring in tricia rose and bring everyone in to discuss the real factor in the debate. and then when we come back big bird versus sheldon adelson. what actually cost our government so much more money. >> i'm sorry jim i'm going to stop the subsidy to pbs. i like pbs. i love big bird. i actctctctctctctctctctctctctctctctctctctctctctctctctctctctctctct (vo) she gets the comedians laughing and the thinkers thinking. >>ok, so there's wiggle room in the ten commandments, that's what you're saying. (vo) she's joy behar. >>current will let me say anything. [ ♪ theme music ♪ ] >> cenk: everybody remembers that big bird moment were last night's debate. this is where mitt romney said he would get tough on the budget by going after p bs. >> romney: i'm sorry jim i'll stop the subsidy to pbs. i like pbs. i like big bird, i like you. but i'm not going to borrow money from china to pay for it. >> cenk: i like you, too how con descending did
thank you for joining us, i really appreciate it. >> my pleasure. take care. >> cenk: stay tune for that segment, and we'll bring in tricia rose and bring everyone in to discuss the real factor in the debate. and then when we come back big bird versus sheldon adelson. what actually cost our government so much more money. >> i'm sorry jim i'm going to stop the subsidy to pbs. i like pbs. i love big bird. i actctctctctctctctctctctctctctctctctctctctctctctctctctctctctctct (vo) she...
132
132
Oct 26, 2012
10/12
by
CURRENT
tv
eye 132
favorite 0
quote 0
thanks for joining us, and don't hesitate to give us a call at 866-55-press or join us on twitter @bpshow. in its latest issue, playboy magazine warns if elected mitt romney and paul ryan would try to shut down any recreational sex. that's a reason to get out and vote. all right. we'll tell you all about it and interview the author of that story in playboying a mean. but first the latest from lisa ferguson out in los angeles. >> good morning, everybody. it seems republicans just can't stay away from offensive rape comments this season. still no official policy from richard mourdock. several gop candidates are still supporting him including mitt romney and now ohio senate nominee, josh mendel. many women would likely disagree, and now tina faye is helping to stand up for women. here she is on wednesday. >> i wish we could have an honest and respectful dialogue about these complicated issues but it seems like we can't right now. >> looks like we're having a little bit of problem with that clip, but she says if she has to listen with one more gray-faced man with a $2 haircut explain what rap
thanks for joining us, and don't hesitate to give us a call at 866-55-press or join us on twitter @bpshow. in its latest issue, playboy magazine warns if elected mitt romney and paul ryan would try to shut down any recreational sex. that's a reason to get out and vote. all right. we'll tell you all about it and interview the author of that story in playboying a mean. but first the latest from lisa ferguson out in los angeles. >> good morning, everybody. it seems republicans just can't...
186
186
Oct 16, 2012
10/12
by
CURRENT
tv
eye 186
favorite 0
quote 0
check us out on line at current.com/thewarroom. thanks for joining us here in "the war room," we'll see you tomorrow night for current wall-to-wall coverage of the second presidential debate. can't wait. you have a great night everybody. >> eliot: good evening i'm eliot spitzer and this is "viewpoint." the stakes could not be higher for president obama heading into tuesday's second presidential debate. the president had maintained a narrow lead in the polls all summer, especially in the key swing states. but since the first presidential debate, more voters have been taking a second look at mitt romney. now the race is simply too close to call. let's go to the national numbers first. the president trails the former massachusetts governor by two points in the latest gallup tracking poll. mr. obama leads romney by a single point in the politico gwu poll and perhaps giving him solace, likely voters in the absence news "washington post" poll give mr. obama a three-point edge over governor romney. turning to 12 swing states that will alm
check us out on line at current.com/thewarroom. thanks for joining us here in "the war room," we'll see you tomorrow night for current wall-to-wall coverage of the second presidential debate. can't wait. you have a great night everybody. >> eliot: good evening i'm eliot spitzer and this is "viewpoint." the stakes could not be higher for president obama heading into tuesday's second presidential debate. the president had maintained a narrow lead in the polls all summer,...
103
103
Oct 13, 2012
10/12
by
CURRENT
tv
eye 103
favorite 0
quote 0
that brings us to the number of the day--three. the third highest debate research term last night was malarky. that c characterized the whole evening. it became this week's big board. an old slang word of possibly greek or irish origin meaning deceptive talk or nonsense, and paul ryan, shall we say was full of it. joe biden said malarky the first time when ryan mentioned defense cuts and mentioned that ryan's budget cuts embassy security $300 million. and then when saying obama opposed sanctions when obama administration tightened sanctions. and sometimes [ voice of dennis ] ...safe driving bonus check? every six months without an accident, allstate sends a check. ok. [ voice of dennis ] silence. are you in good hands? [ crowd cheers ] [ male announcer ] clay matthews is turning the nfl upside-down. turn your world upside down with gillette fusion proglide because you can shave against the grain with comfort. only proglide has gillette's thinnest blades for less tug and pull, so you can shave against the grain comfortably. fusion p
that brings us to the number of the day--three. the third highest debate research term last night was malarky. that c characterized the whole evening. it became this week's big board. an old slang word of possibly greek or irish origin meaning deceptive talk or nonsense, and paul ryan, shall we say was full of it. joe biden said malarky the first time when ryan mentioned defense cuts and mentioned that ryan's budget cuts embassy security $300 million. and then when saying obama opposed...
215
215
Oct 30, 2012
10/12
by
CURRENT
tv
eye 215
favorite 0
quote 0
he used to be a congressman as well. it will be interesting to see how that plays out. and then ami bera against dan lundgren, a long-time republican. it could go either way that long-time republican could lose his seat. then my favorite, tammy duckworth versus joe walsh. well joe, it was nice knowing you. why is he down so much? it may be comments like this. >> they wants the hispanic vote. they want the hispanic dependent on government. just like they have african-americans dependent on government. >> there is no exemptions. >> don't blame the marketplace for the mess we're in now. i'm tired of h >> pick this president up, pat him on the head and say son son. >> cenk: well, we're about to pat you on the head and say son, son son there's the friggin' door, enjoy it. i wish the host had predicted this earlier hmm. >> joe walsh, the clown of the earth. he thinks on medicare you have to double down, go harder at it. he's first-termer. he's going to be wanted out. i would be surprised if he survived that first term. he's a bull in the china shop. he has no idea what he's d
he used to be a congressman as well. it will be interesting to see how that plays out. and then ami bera against dan lundgren, a long-time republican. it could go either way that long-time republican could lose his seat. then my favorite, tammy duckworth versus joe walsh. well joe, it was nice knowing you. why is he down so much? it may be comments like this. >> they wants the hispanic vote. they want the hispanic dependent on government. just like they have african-americans dependent on...
202
202
Oct 27, 2012
10/12
by
CURRENT
tv
eye 202
favorite 0
quote 0
but move it does, which brings us to the number of day--16. that's how many banks have received subpoenas in this growing scandal. along with the seven banks we have known about before today the wall street journal reported nine other banks were served in september and august. these include major financial institutions such as bank of america. bank of tokyo credit swees and the royal babank of canada. but that should not be a surprise. because 20 banks set up libor which helps define interest rates between banks. with just three banks involved it would be difficult to manipulate the rate. banks cry out once again for deregulation and free market fundamentalist maintain the business world can police itself the libor current tv encourages you to vote on november 6th but just as importantly to take the time to learn about each candidate's stance on the issues that matter to you. to help you make informed decisions, watch current tv's politically direct lineup. only on current tv. vote smart. our democracy depends on an informed electorate. >> eli
but move it does, which brings us to the number of day--16. that's how many banks have received subpoenas in this growing scandal. along with the seven banks we have known about before today the wall street journal reported nine other banks were served in september and august. these include major financial institutions such as bank of america. bank of tokyo credit swees and the royal babank of canada. but that should not be a surprise. because 20 banks set up libor which helps define interest...
190
190
Oct 20, 2012
10/12
by
CURRENT
tv
eye 190
favorite 0
quote 0
syrians initially did not want us involved. there was not a good libya-style solution. >> gavin: right. >> it was very reasonable it to back off for a long time. on another hand i think what we're seeing over time is that the risks of inaction have been rising considerably, and that the poisons of syria are spilling out into other countries, destabilizeing lebanon, destabilizing iraq. i think we would be better off having this resolved more quickly. how is this going to end? it will end with president assad out. >> gavin: are you that confident? everyone says that is inevitable. even a year ago and you continue to say it as if it's certain. there is no sign that he's sort of stabilizing things? >> i don't think so. >> gavin: what is the indication of that? >> i'm sure this will end with him out. i don't know if that's going to take the form of him retiring to some other country or if it will be other commanders pushing him out as part of a deal or the military victory and he's overrun. but i am convinced this will end with assa
syrians initially did not want us involved. there was not a good libya-style solution. >> gavin: right. >> it was very reasonable it to back off for a long time. on another hand i think what we're seeing over time is that the risks of inaction have been rising considerably, and that the poisons of syria are spilling out into other countries, destabilizeing lebanon, destabilizing iraq. i think we would be better off having this resolved more quickly. how is this going to end? it will...
140
140
Oct 25, 2012
10/12
by
CURRENT
tv
eye 140
favorite 0
quote 0
thank you for joining us. when we come back we'll find out what president bill clinton is helping to do to woo women. and brett has some tips. right by those who gave their lives to for this country nearly 70 years ago. [ male announcer ] red lobster's hitting the streets to tell real people about our new 15 under $15 menu. oh my goodness! oh my gosh this looks amazing! that's a good deal! [ man ] wow! it is so good! [ male announcer ] our new maine stays! 15 entrees under $15 seafood, chicken and more! oo! the tilapia with roasted vegetables! i'm actually looking at the wood grilled chicken with portobello wine sauce. you so fascinated by the prices, you keep rambling on! i know! -that pork chop was great! -no more fast food friday's! so we gotta go! we're going to go to red lobster. yep. [ male announcer ] try our 15 under $15 menu and sea food differently! jennifer speaks truth to power. >>the bottom line is we need an amendment. >>now it's your turn. connect with "the war room" jennifer granholm. >>it's a
thank you for joining us. when we come back we'll find out what president bill clinton is helping to do to woo women. and brett has some tips. right by those who gave their lives to for this country nearly 70 years ago. [ male announcer ] red lobster's hitting the streets to tell real people about our new 15 under $15 menu. oh my goodness! oh my gosh this looks amazing! that's a good deal! [ man ] wow! it is so good! [ male announcer ] our new maine stays! 15 entrees under $15 seafood, chicken...
162
162
Oct 3, 2012
10/12
by
CURRENT
tv
eye 162
favorite 0
quote 0
that's for you guys to use. but people are really -- private sector is really hampered greatly -- i mean greatly by some of the regulations. that are put on them. the amount -- the amount of regulation that small businessmen have to go through. but government has grown out of size. i think what we can agree on and i hope we can is that the government union heads they're truly the 1%. they confiscate rank and file members. they get 10 to 15 times what rank and file members get paid. a secretary treasurer in 2010 of afscme got paid $847,000 and afscme president afscme's president in 18 months spent $325,000 on private jets for himself in 2010. and he also made well over half a million dollars. >> jennifer: i have no idea -- what they're making. but we could also make the same argument about the disparities in ceo pay compared to worker pay but that's not -- >> absolutely. >> jennifer: that's not what your book is about. >> yes, it is. >> jennifer: the same part of your book, just to go back to this for a second. i
that's for you guys to use. but people are really -- private sector is really hampered greatly -- i mean greatly by some of the regulations. that are put on them. the amount -- the amount of regulation that small businessmen have to go through. but government has grown out of size. i think what we can agree on and i hope we can is that the government union heads they're truly the 1%. they confiscate rank and file members. they get 10 to 15 times what rank and file members get paid. a secretary...
116
116
Oct 30, 2012
10/12
by
CURRENT
tv
eye 116
favorite 0
quote 0
they were never used. that's one of the examples i think where fema comes into a state telling the state you're taking them. but we don't want them back. now i don't think that's right. i think that they should have been used somewhere else when needed. but fema didn't want them. they go nope. they're your problem. they were parked -- i don't know for how long. i think they finally got them destroyed because they were never used. >> bill: i don't know anything about that, charles but i do know this. that's not the way fema works today. i think you have to look at the way fema works today and the way it has worked since president obama has been in the white house. again, it is not just me saying this there's been nothing but praise for fema and craig if fugate from republican governors. mcdonnell in virginia. chris christie in new jersey. even bobby jindal in louisiana. have praised the fact right now there is a close partnership between the white house and the governor's republican and democratic governors
they were never used. that's one of the examples i think where fema comes into a state telling the state you're taking them. but we don't want them back. now i don't think that's right. i think that they should have been used somewhere else when needed. but fema didn't want them. they go nope. they're your problem. they were parked -- i don't know for how long. i think they finally got them destroyed because they were never used. >> bill: i don't know anything about that, charles but i do...
236
236
Oct 25, 2012
10/12
by
CURRENT
tv
eye 236
favorite 0
quote 1
it's so convenient and easy to use. with go to meeting you can access your entire mac or pc and talk with the tools that you work with. >> and why are you looking at me? [ laughter ] >> stephanie: try go to meeting today. click on the try it free button enter the promo code stephanie. and then download the free app. try it free, with the promo code stephanie. >> a beautifully wrapped, glossy, sweet-melling show. >> announcer: it's the "stephanie miller show." ♪ what the current audience can expect from my show is the unexpected. >>stephanie miller challenges the system, now it's your turn. >>it's a little bit of magic. >>connect with "talking liberally with stephanie miller" at facebook.com/stephaniemillershow and on twitter at smshow. ♪ >> announcer: stephanie miller. ♪ i will survive, as long as i know how to love i know i'll stay alive ♪ ♪ i'll got all my life to live i got all my love to give and i will survive, i will survive, hey, hey ♪ >> stephanie: hey, hey. >> hold on i'm watching an romney event an
it's so convenient and easy to use. with go to meeting you can access your entire mac or pc and talk with the tools that you work with. >> and why are you looking at me? [ laughter ] >> stephanie: try go to meeting today. click on the try it free button enter the promo code stephanie. and then download the free app. try it free, with the promo code stephanie. >> a beautifully wrapped, glossy, sweet-melling show. >> announcer: it's the "stephanie miller show."...
239
239
Oct 5, 2012
10/12
by
CURRENT
tv
eye 239
favorite 0
quote 0
most of us already know who we're going to vote for. i don't believe a lot of the people who call themselves moderates or whatever are as moderate as they say they are (vo) john fugelsang sees what happens. >> you know, blaming this economy on barack obama is kinda like blaming your hangover on the guy making breakfast. i like mitt romney but i'm sorry. they guy has flipped more than a crack house mattress. this campaign has become so toxic, beverly hills housewives are now injecting it into their foreheads. (vo) so current gave him a weekly show. >> i love romney's debate style, but i tell you, if i could be that stiff for 90 minutes, i'd ... (vo) we probably won't regret it. break the ice with breath-freshening cooling crystals. ice breakers. ♪ >> james woods promised to introduce me to >> announcer: stephanie miller. >> but instead he introduced me to danny bonaduce. like meeting a dog turning 30. [ laughter ] >> stephanie: all right. thirtity-four minutes after the hour. about olivia nun -- >> munn. >> stephanie: what did i say? >
most of us already know who we're going to vote for. i don't believe a lot of the people who call themselves moderates or whatever are as moderate as they say they are (vo) john fugelsang sees what happens. >> you know, blaming this economy on barack obama is kinda like blaming your hangover on the guy making breakfast. i like mitt romney but i'm sorry. they guy has flipped more than a crack house mattress. this campaign has become so toxic, beverly hills housewives are now injecting it...
403
403
Oct 24, 2012
10/12
by
CURRENT
tv
eye 403
favorite 0
quote 0
trying to convince himself or us or all of us at the same time? >> stephanie: he's trying to hypnotize us. i've always said last resort. i would not let detroit go bankrupt. >> the golfing is great at the last resort. >> stephanie: we have always been at war with east asia. >> the last open road to get to the last resort? >> the last open road to the last resort. of course i did. of course i did. you're a chicken. >> america goes what! >> stephanie: 18 minutes after the hour. back with more rick overton live in studio on "the stephanie miller show". >> otherwise you're going to have all idiots listening to your familiar. >> announcer: it's "the stephanie miller show." always outspoken, now unleashed: joy behar. on my next show i'll talk to parker posey. she's the star of "a mighty wind" and no, that's now what comes out of rush limbaugh. only on current tv. [ ♪ music ♪ ] >> this is a vintage arizona state university shirt. it's the only college mascot. >> stephanie: the won a stanley cup. >> yes, they did. >> stephanie: oh, good to know. >> th
trying to convince himself or us or all of us at the same time? >> stephanie: he's trying to hypnotize us. i've always said last resort. i would not let detroit go bankrupt. >> the golfing is great at the last resort. >> stephanie: we have always been at war with east asia. >> the last open road to get to the last resort? >> the last open road to the last resort. of course i did. of course i did. you're a chicken. >> america goes what! >> stephanie: 18...
394
394
Oct 12, 2012
10/12
by
CURRENT
tv
eye 394
favorite 0
quote 0
stay with us. use as directed. then how'd i get this... [ voice of dennis ] ...allstate safe driving bonus check? what is that? so weird, right? my agent, tom, said... [ voice of dennis ] ...only allstate sends you a bonus check for every six months you're accident-free... ...but i'm a woman. maybe it's a misprint. does it look like a misprint? ok. what i was trying... [ voice of dennis ] silence. ♪ ♪ ask an allstate agent about the safe driving bonus check. are you in good hands? you've heard stephanie's views. >>no bs, authentic, the real thing. >>now, let's hear yours at the only online forum with a direct line to stephanie miller. >>the only thing that can save america now: current television. >>join the debate now. [ ♪ theme music ♪ ] >> announcer: ladies and gentlemen, it's the "stephanie miller show"! ♪ i'm walking on sunshine woe ho ♪ ♪ i'm walking on sunshine woe ho ♪ ♪ it's time to feel good hey all right now ♪ ♪ it's time to feel good ♪ >> stephanie: everybody put on their best jo
stay with us. use as directed. then how'd i get this... [ voice of dennis ] ...allstate safe driving bonus check? what is that? so weird, right? my agent, tom, said... [ voice of dennis ] ...only allstate sends you a bonus check for every six months you're accident-free... ...but i'm a woman. maybe it's a misprint. does it look like a misprint? ok. what i was trying... [ voice of dennis ] silence. ♪ ♪ ask an allstate agent about the safe driving bonus check. are you in good hands? you've...
288
288
Oct 3, 2012
10/12
by
CURRENT
tv
eye 288
favorite 0
quote 0
they're not coming for us. you have the romney campaign and other people coming out saying we knew this was a terrorist thing. we know exactly where they are. you're not helping. >> stephanie: exactly. [ ♪ "world news tonight" ♪ ] a feature you're not helping for current jacki she schechner. >> quite a segue. >> stephanie: i'm queen segue. since we just did right-wing world. i know you played the audio at the top of the thing but he literally said some doctors perform abortions on women -- women that aren't pregnant. >> on the house floor in 2008, he gave a big ole speech. he said that doctors who perform abortions or abortionists he called them, the lowest on the food chain and they perform these abortions in kits with unsanitary conditions and that they perform them on women who don't need them. because i can't think of anything i would rather do with a free day than get an abortion i don't need. >> stephanie: right. >> which would be yeah, then you get a coupon. how does that work? when you terminate a p
they're not coming for us. you have the romney campaign and other people coming out saying we knew this was a terrorist thing. we know exactly where they are. you're not helping. >> stephanie: exactly. [ ♪ "world news tonight" ♪ ] a feature you're not helping for current jacki she schechner. >> quite a segue. >> stephanie: i'm queen segue. since we just did right-wing world. i know you played the audio at the top of the thing but he literally said some doctors...
130
130
Oct 17, 2012
10/12
by
CURRENT
tv
eye 130
favorite 0
quote 0
and they provide us energy and they provide us innovation. and they start companies like intel and google and we want to encourage that. now, we've gotta make sure that we do it in a smart way and a comprehensive way and a legal system better. but when we make this into a divisive political issue and when we don't have bipartisan support, i can deliver governor. a whole bunch of democrats to get comprehensive immigration reform done. >> romney: i'll get it done. first year. >> mr. president, let me move you on here. >> obama: it is time for them to get serious on it. it used to be a bipartisan issue. >> don't go away. >> obama: i'm here. >> i want you to talk to carrie who wants to switch the topic for us. >> okay. hi carrie. >> good evening mr. president. >> obama: i'm sorry. what is your name? >> carry. this question actually comes from a brain trust of my friends at global telecom supply in mineola yesterday. we were sitting around talking about libya. we were reading and became aware of reports that the state department refused extra secu
and they provide us energy and they provide us innovation. and they start companies like intel and google and we want to encourage that. now, we've gotta make sure that we do it in a smart way and a comprehensive way and a legal system better. but when we make this into a divisive political issue and when we don't have bipartisan support, i can deliver governor. a whole bunch of democrats to get comprehensive immigration reform done. >> romney: i'll get it done. first year. >> mr....
217
217
Oct 26, 2012
10/12
by
CURRENT
tv
eye 217
favorite 0
quote 0
stay with us. ♪ to you. to help you make informed decisions, watch current tv's politically direct lineup. only on current tv. vote smart. our democracy depends on an informed electorate. what we need are people prepared for the careers of our new economy. by 2025 we could have 20 million jobs without enough college graduates to fill them. that's why at devry university we're teaming up with companies like cisco to help make sure everyone is ready with the know-how we need for a new tomorrow. [ male announcer ] make sure america's ready. make sure you're ready. at devry.edu/knowhow. ♪ ♪ rich, chewy caramel rolled up in smooth milk chocolate. don't forget about that payroll meeting. rolo.get your smooth on. also in minis. [ ♪ theme music ♪ ] >> announcer: ladies and gentlemen, it's the "stephanie miller show"! ♪ i'm walking on sunshine woe ho ♪ ♪ i'm walking on sunshine woe ho ♪ ♪ it's time to feel good ♪ ♪ hey all right now ♪ ♪ it's time to feel good ♪ >> the "stephanie miller sho
stay with us. ♪ to you. to help you make informed decisions, watch current tv's politically direct lineup. only on current tv. vote smart. our democracy depends on an informed electorate. what we need are people prepared for the careers of our new economy. by 2025 we could have 20 million jobs without enough college graduates to fill them. that's why at devry university we're teaming up with companies like cisco to help make sure everyone is ready with the know-how we need for a new tomorrow....
167
167
Oct 19, 2012
10/12
by
CURRENT
tv
eye 167
favorite 0
quote 0
can you tell us who or can you guess who it's going to be? text us at or tweet us at @tytoncurrent. we have more. outrage that they're doing this, this corruption based on corruption based on corruption. >>i think that's an understatement, eliot. u>> i'm not prone tot. understatement, so explain to me why that is. i think the mob learned from wall st., not vice versa. [ ♪ theme music ♪ ] >> as every election year brings us, there are a ton of ballot initiatives and ballots on the books going out before the voters in states all across the country, none probably as interesting as amendment 64 in colorado, which is will the legalization and possession of the use of marijuana. here is more about that. >> she and her husband once run a marijuana dispensary and marketed foods with marijuana in them. now a state constitutional amendment to make it legal in colorado for adults over 21 to possess one ounce of marijuana and grow up to six plants for personal use. colorado is already one of 17 states that allow marijuana for medical use. the business pumps $11 million a year into colorado
can you tell us who or can you guess who it's going to be? text us at or tweet us at @tytoncurrent. we have more. outrage that they're doing this, this corruption based on corruption based on corruption. >>i think that's an understatement, eliot. u>> i'm not prone tot. understatement, so explain to me why that is. i think the mob learned from wall st., not vice versa. [ ♪ theme music ♪ ] >> as every election year brings us, there are a ton of ballot initiatives and ballots...
369
369
Oct 18, 2012
10/12
by
CURRENT
tv
eye 369
favorite 0
quote 0
karl frisch rejoins us for right-wing world. rush limbaugh. >> obama's facial expressions, agitated, mean nasty-looking at times, it showed undecided voters that he is virtually impossible to reason or do business with. >> did he look arrogant to you? [ laughter ] >> full of himself like he thinks he was god's gift. olive gift. >> stephanie: angry and muslimy. >> to have rush limbaugh hire a body language -- you know interpreter, i would think that rush is in the market for a new bride, but -- [ laughter ] >> stephanie: apparently he has not yet asked for the binder of women. >> stephanie: would you say, i don't mean to lead you or anything, does he seem arrogant to you, up itty -- >> does he seem as if he would ever send white house staff to pick up his medication perhaps high dosage painkillers, risk his entire career all for the sweet, sweet knockout power of oxycontin. [ laughter ] >> stephanie: steve doocy. >> look for some type of a strike in a timely fashion before. >> the debate is going to be 9:00 pm so probably before
karl frisch rejoins us for right-wing world. rush limbaugh. >> obama's facial expressions, agitated, mean nasty-looking at times, it showed undecided voters that he is virtually impossible to reason or do business with. >> did he look arrogant to you? [ laughter ] >> full of himself like he thinks he was god's gift. olive gift. >> stephanie: angry and muslimy. >> to have rush limbaugh hire a body language -- you know interpreter, i would think that rush is in the...
142
142
Oct 23, 2012
10/12
by
CURRENT
tv
eye 142
favorite 0
quote 0
join us. i'm like where? are you going to be at the rage where it's $10 for a drinks and a sandwich. and i clicked on the thing, and there was nothing more. >> stephanie: and michelle always pulling at any heart strings. >> i didn't get one from her. >> stephanie: this is barack's last denate in his last campaign. >> i got one from barbara streisand. she wants money, and i'm like lady we haven't even met. >> so that's what she meant by evergreen. >> stephanie: more of my green. >> i keep getting them from james carville. >> stephanie: when i get the phone calls, i'm like i already popped for two of the big concerts. i'm out. >> they are calling your house phone. >> stephanie: oh, yeah because they know i'm old. i can get some more money by pony express. [ laughter ] >> stephanie: twenty-five minutes after the hour. right back on the "stephanie miller show." ♪ >>oh really? >>tax cuts don't create jobs. the golden years as the conservatives call them, we had the highest tax rates, and the highest amount of gr
join us. i'm like where? are you going to be at the rage where it's $10 for a drinks and a sandwich. and i clicked on the thing, and there was nothing more. >> stephanie: and michelle always pulling at any heart strings. >> i didn't get one from her. >> stephanie: this is barack's last denate in his last campaign. >> i got one from barbara streisand. she wants money, and i'm like lady we haven't even met. >> so that's what she meant by evergreen. >>...
221
221
Oct 19, 2012
10/12
by
CURRENT
tv
eye 221
favorite 0
quote 1
progressive joins us now. what is the latest polling? >> this race is a dead heat. it is -- it is just neck and neck in wisconsin, and it is also the second-most expensive senate race in the united states of america, because outside groups are coming in and just pouring call lossal amounts of cash into this race. and the largest is karl rove's cross roads, which has put $5 million bucks into wisconsin to try to pull this thing for tommy thompson. >> stephanie: tommy thompson admits he just sold iran stocks that day. >> oops. that was last night. he himself had millions of dollars invested in the mining operation which is partnering with the government of iran to mine uranium in africa. he said well, i sold that stock today. >> stephanie: yeah. yeah. it's hilarious. she said i find that shocking. if you want to be stuff on iran we have to make that sure companies don't do business. >> yeah, and his excuse was his stockbroker was just disclosed -- and this was a disclosure from months ago -- so kind of like that
progressive joins us now. what is the latest polling? >> this race is a dead heat. it is -- it is just neck and neck in wisconsin, and it is also the second-most expensive senate race in the united states of america, because outside groups are coming in and just pouring call lossal amounts of cash into this race. and the largest is karl rove's cross roads, which has put $5 million bucks into wisconsin to try to pull this thing for tommy thompson. >> stephanie: tommy thompson admits...
115
115
Oct 24, 2012
10/12
by
CURRENT
tv
eye 115
favorite 0
quote 0
he comes to us tonight from los angeles. he's a partner with the fox law firm and he served in several high profile roles in u.s. state departments and in the united nations. welcome back inside "the war room." >> governor, it is great to be here. thanks for having me. >> jennifer: you bet. you tweeted about this. why was that the most important exchange of the debate especially since the fact checkers say president obama did not go on an apology tour. >> when you look at the cairo speech and the transcript, you can say he went overseas to the heart of the arab world and said the reason that there's trouble here in the arab world is because of colonialism and because of the cold war being used as proxies and he talked about palestinians being humiliated by our ally, israel. i think what governor romney is saying is that in a romney administration, we're going to go back to american leadership. we're going to go back to the kind of leadership that a democrat, john kennedy talked about in his inaugural speech. we don't hear le
he comes to us tonight from los angeles. he's a partner with the fox law firm and he served in several high profile roles in u.s. state departments and in the united nations. welcome back inside "the war room." >> governor, it is great to be here. thanks for having me. >> jennifer: you bet. you tweeted about this. why was that the most important exchange of the debate especially since the fact checkers say president obama did not go on an apology tour. >> when you...